Details of Primer Pair 'ABC13578_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC13578_L01R01459Nils Rostoks2004-01-26 ABC13578_L01 CTCGAATTTCCGGTGGCATC 840 20 Nils Rostoks 2004-01-26 Illumina
ABC13578_R01 CACTAACCGGAGGCCCATTG 1298 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC13578_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes