Details of Primer Pair 'ABC13614_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC13614_L01R01428Nils Rostoks2004-01-26 ABC13614_L01 GTTATGGGAAGCGTGTGCCC 1255 20 Nils Rostoks 2004-01-26 Illumina
ABC13614_R01 ACAGCATGAGCCACCCAACA 1682 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC13614_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes