Details of Primer Pair 'ABC13652_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC13652_L01R01405Nils Rostoks2004-01-26 ABC13652_L01 AGGCGATGGAGAAGGACGTG 962 20 Nils Rostoks 2004-01-26 Illumina
ABC13652_R01 TCACGAAAATGCGAGGCAAA 1366 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC13652_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes