Details of Primer Pair 'ABC13678_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC13678_L01R01562Nils Rostoks2004-01-26 ABC13678_L01 CGACGGCCAATACCTTCCTG 400 20 Nils Rostoks 2004-01-26 Illumina
ABC13678_R01 TCGGTCTCATGTCTGCAGGG 961 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC13678_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes