Details of Primer Pair 'ABC13753_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC13753_L01R01423Nils Rostoks2004-01-26 ABC13753_L01 AGGTCACAAGAACGGGCAGC 647 20 Nils Rostoks 2004-01-26 Illumina
ABC13753_R01 ACACGCAAACGTGCACCACT 1069 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC13753_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes