Details of Primer Pair 'ABC14026_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14026_L01R01421Nils Rostoks2004-01-26 ABC14026_L01 GCCGAAGATCCCGTCCATTT 854 20 Nils Rostoks 2004-01-26 Illumina
ABC14026_R01 CCGTCAGTTCATCCGATCCC 1274 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14026_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes