Details of Primer Pair 'ABC14060_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14060_L01R01591Nils Rostoks2004-05-27 ABC14060_L01 ATCCGTGGCAAGCTGGAGAG 510 20 Nils Rostoks 2004-05-27 Qiagen
ABC14060_R01 AACAATGTGTTGCGGCATCG 1101 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC14060_L01R01'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined