Details of Primer Pair 'ABC14079_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14079_L01R010Nils Rostoks2005-03-17 ABC14079_L01 AAAATAAGGTTTCTTGTTCTTGG 0 23 Nils Rostoks 2005-03-17 Invitrogen
ABC14079_R01 GAAACCCTGTTGAAGTACGG 102 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC14079_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB