Details of Primer Pair 'ABC14148_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14148_L01R01481Nils Rostoks2004-01-26 ABC14148_L01 GCTGGCCAGGAGAGGTTTAGG 424 21 Nils Rostoks 2004-01-26 Illumina
ABC14148_R01 CCTGCGATACGGTGACCACA 904 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14148_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes