Details of Primer Pair 'ABC14167_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14167_L01R01468Nils Rostoks2004-01-26 ABC14167_L01 ACAACGCCTCCCCACTACGA 257 20 Nils Rostoks 2004-01-26 Illumina
ABC14167_R01 CGGCATTGTTTCACCACAGC 724 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14167_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes