Details of Primer Pair 'ABC14307_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14307_L01R01402Nils Rostoks2004-01-26 ABC14307_L01 TGGAGCAGCTGTTCTCGGTG 573 20 Nils Rostoks 2004-01-26 Illumina
ABC14307_R01 CCAAGAGGCCAAAACTGTGGA 974 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14307_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes