Details of Primer Pair 'ABC14350_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14350_L01R01492Nils Rostoks2004-01-26 ABC14350_L01 GGCGACGTGCTCTGGAATCT 431 20 Nils Rostoks 2004-01-26 Illumina
ABC14350_R01 GAACCGCAACTCCAGTGCCT 922 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14350_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes