Details of Primer Pair 'ABC14397_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14397_L01R01451Nils Rostoks2004-01-26 ABC14397_L01 GGCCAGCGCTACTTCCTCAA 557 20 Nils Rostoks 2004-01-26 Illumina
ABC14397_R01 GCCATGAATGGCCATCAACA 1007 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14397_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes