Details of Primer Pair 'ABC14522_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14522_L01R01532Nils Rostoks2004-01-26 ABC14522_L01 AGAACATGAGCAGGCTCGGC 286 20 Nils Rostoks 2004-01-26 Illumina
ABC14522_R01 GTGGTCTGTGGCCTCGTGTG 817 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14522_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes