Details of Primer Pair 'ABC14531_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14531_L01R01411Nils Rostoks2004-01-26 ABC14531_L01 TGGGCTCTCAGATTCCACGG 562 20 Nils Rostoks 2004-01-26 Illumina
ABC14531_R01 TTCCATGCAAATGCCTGCTG 972 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14531_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes