Details of Primer Pair 'ABC14534_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14534_L01R01572Nils Rostoks2004-01-26 ABC14534_L01 CGTCGTGCTCGAAAGCTTGA 645 20 Nils Rostoks 2004-01-26 Illumina
ABC14534_R01 CGTCAACGCAGCACGCTACT 1216 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14534_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes