Details of Primer Pair 'ABC14535_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14535_L01R01429Nils Rostoks2004-01-26 ABC14535_L01 CTCCGACCTCATGTCCACCA 313 20 Nils Rostoks 2004-01-26 Illumina
ABC14535_R01 GCTGGGAGGAAACCACATGC 741 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14535_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes