Details of Primer Pair 'ABC14544_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14544_L01R01453Nils Rostoks2004-01-26 ABC14544_L01 CGGTCGCCAGTCTACACACG 816 20 Nils Rostoks 2004-01-26 Illumina
ABC14544_R01 CCATCCCAATGTTCTGCTCG 1268 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14544_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes