Details of Primer Pair 'ABC14681_L03R03'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14681_L03R030Nils Rostoks2004-05-27 ABC14681_L03 TTGCCGTTGGAGAGTAATTTTGAC 281 24 Nils Rostoks 2004-05-27 Qiagen
ABC14681_R03 CAGGCGCGAGATCGAACAC 0 19 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC14681_L03R03'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined