Details of Primer Pair 'ABC14687_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14687_L01R01414Nils Rostoks2004-01-26 ABC14687_L01 ATGTCCTTCATCCTGGGGCA 102 20 Nils Rostoks 2004-01-26 Illumina
ABC14687_R01 GCCGGCCAACTCAACAAAAG 515 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14687_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes