Details of Primer Pair 'ABC14689_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14689_L01R01456Nils Rostoks2004-01-26 ABC14689_L01 TCTCTGCTTCACCTGGCGTG 105 20 Nils Rostoks 2004-01-26 Illumina
ABC14689_R01 GGGTCCCCTGGCTCCATAAG 560 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14689_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes