Details of Primer Pair 'ABC14759_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14759_L01R01656Nils Rostoks2004-05-27 ABC14759_L01 AGCAGTGCCTTGCTGAGTCG 558 20 Nils Rostoks 2004-05-27 Qiagen
ABC14759_R01 ACACCAGACGCTCGCAGATG 1214 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC14759_L01R01'

2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined