Details of Primer Pair 'ABC14818_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14818_L01R01487Nils Rostoks2004-01-26 ABC14818_L01 CCCCAAAAATGCTTGCCAAA 835 20 Nils Rostoks 2004-01-26 Illumina
ABC14818_R01 CCTTGACGTGCAGCCTTCAT 1321 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14818_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes