Details of Primer Pair 'ABC14826_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14826_L01R01476Nils Rostoks2004-01-26 ABC14826_L01 GCTGCTCACGGACCAGTTCA 190 20 Nils Rostoks 2004-01-26 Illumina
ABC14826_R01 GCACGACAATCGAACGATGA 665 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14826_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes