Details of Primer Pair 'ABC14849_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14849_L01R01406Nils Rostoks2004-01-26 ABC14849_L01 GGGAAGGCGATCTTGTGCAG 156 20 Nils Rostoks 2004-01-26 Illumina
ABC14849_R01 AAACACCAGCGGTTCCTTGG 561 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14849_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes