Details of Primer Pair 'ABC14943_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC14943_L01R01459Nils Rostoks2004-01-26 ABC14943_L01 GGGCAATGCGATTGATCCTC 604 20 Nils Rostoks 2004-01-26 Illumina
ABC14943_R01 CGCCAATCACGCGGTACATA 1062 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC14943_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes