Details of Primer Pair 'ABC15094_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15094_L01R01417Nils Rostoks2004-01-26 ABC15094_L01 ACTCACCCAGACCAGCGACC 245 20 Nils Rostoks 2004-01-26 Illumina
ABC15094_R01 GGGACGTGAACCCATTCCAG 661 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC15094_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes