Details of Primer Pair 'ABC15151_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15151_L01R01492Nils Rostoks2004-01-26 ABC15151_L01 GCAGGCCTCTGTACCTCGGA 228 20 Nils Rostoks 2004-01-26 Illumina
ABC15151_R01 CCATGCAAAAGCCACAGCAG 719 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC15151_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes