Details of Primer Pair 'ABC15164_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15164_L01R01458Nils Rostoks2004-01-26 ABC15164_L01 ATCCGGGAGGCGTTCAGACT 282 20 Nils Rostoks 2004-01-26 Illumina
ABC15164_R01 CGAATTCACGGGCGGTAGAG 739 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC15164_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes