Details of Primer Pair 'ABC15204_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15204_L01R01476Nils Rostoks2004-01-26 ABC15204_L01 GCATGTAACCCAAGCCCTGC 565 20 Nils Rostoks 2004-01-26 Illumina
ABC15204_R01 TAGCTCACACGAACGACGCC 1040 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC15204_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes