Details of Primer Pair 'ABC15259_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15259_L01R01409Nils Rostoks2004-01-26 ABC15259_L01 GGAGGATGCTCGGCTCAGTC 279 20 Nils Rostoks 2004-01-26 Illumina
ABC15259_R01 ATTGGCAGCCCATTCTCCCT 687 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC15259_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes