Details of Primer Pair 'ABC15266_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15266_L01R01428Nils Rostoks2004-01-26 ABC15266_L01 ACGTGAAGTGCGCAAAGCAG 716 20 Nils Rostoks 2004-01-26 Illumina
ABC15266_R01 GAGCTCTGCTACCGGCCTCA 1143 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC15266_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes