Details of Primer Pair 'ABC15296_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15296_L01R01416Nils Rostoks2004-01-26 ABC15296_L01 ATTGCGAGAATGATGCCGCT 1135 20 Nils Rostoks 2004-01-26 Illumina
ABC15296_R01 CGGTGACATGGGGACCAATTA 1550 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC15296_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes