Details of Primer Pair 'ABC15334_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15334_L01R01174Nils Rostoks2005-03-17 ABC15334_L01 GGGAGCCGTAAGTAAGAACC 369 20 Nils Rostoks 2005-03-17 Invitrogen
ABC15334_R01 CGACCTCTGAATCTCAAATCC 543 21 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC15334_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB