Details of Primer Pair 'ABC15349_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15349_L01R01416Nils Rostoks2004-01-26 ABC15349_L01 GCTCACCTTGTGGCATGTGG 1270 20 Nils Rostoks 2004-01-26 Illumina
ABC15349_R01 GTGCAGAGCACAAACGGACA 1685 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC15349_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes