Details of Primer Pair 'ABC15434_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15434_L01R01400Nils Rostoks2004-01-26 ABC15434_L01 CCCAGTGCCGAATAAGGTGC 600 20 Nils Rostoks 2004-01-26 Illumina
ABC15434_R01 CACAACTGGACGAAGTGCTGC 999 21 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC15434_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes