Details of Primer Pair 'ABC15443_L03R03'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15443_L03R03423Nils Rostoks2004-05-27 ABC15443_L03 TGCCCGAACAAAAGTCATCTG 529 21 Nils Rostoks 2004-05-27 Qiagen
ABC15443_R03 AGCGGAGTCGGTGTAGCATC 952 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC15443_L03R03'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined