Details of Primer Pair 'ABC15492_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15492_L01R01430Nils Rostoks2004-01-26 ABC15492_L01 CTGCAGATGATGCAGCCCC 680 19 Nils Rostoks 2004-01-26 Illumina
ABC15492_R01 TGAACCGTGACGGAGGGAGT 1109 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC15492_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes