Details of Primer Pair 'ABC15559_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15559_L01R01456Nils Rostoks2004-01-26 ABC15559_L01 CTGGGCTGGGAGGTGAGCTA 256 20 Nils Rostoks 2004-01-26 Illumina
ABC15559_R01 CATCCATGCCAGCCATACCA 711 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC15559_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes