Details of Primer Pair 'ABC15798_L02R02'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15798_L02R02472Nils Rostoks2004-05-27 ABC15798_L02 TCCGGCGAAAACTAGCATTGC 504 21 Nils Rostoks 2004-05-27 Qiagen
ABC15798_R02 AGCGCAAGCAGGAGCAGGAG 32 20 Nils Rostoks 2004-05-27 Qiagen

Comment History of 'ABC15798_L02R02'

DateSubmitterComment
2004-05-27 Nils Rostoks Preliminary experiment, many primers were designed from Contest contigs and do not match HarvEST contigs, contig orientation was not checked, sometimes primer start and fragment size could not be determined