Details of Primer Pair 'ABC15807_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15807_L01R01443Nils Rostoks2004-01-26 ABC15807_L01 ACAACATCGTTCACCGCCCT 383 20 Nils Rostoks 2004-01-26 Illumina
ABC15807_R01 CAGCGCTGAGCTGTTGGAAA 825 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC15807_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes