Details of Primer Pair 'ABC15864_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC15864_L01R01167Nils Rostoks2005-03-17 ABC15864_L01 GCATAAACGGGTGTAAGAGC 1142 20 Nils Rostoks 2005-03-17 Invitrogen
ABC15864_R01 CATCCAGTTCAGAGGATAGAGC 975 22 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC15864_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB