Details of Primer Pair 'ABC16075_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC16075_L01R01449Nils Rostoks2004-01-26 ABC16075_L01 CTGGAGAAGGGCCTGTGTGG 185 20 Nils Rostoks 2004-01-26 Illumina
ABC16075_R01 ACAACAGGGCGGTCAATCGT 633 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC16075_L01R01'

2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes