Details of Primer Pair 'ABC16258_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC16258_L01R01422Nils Rostoks2004-01-26 ABC16258_L01 TCCGCCTTCACGACAAAACA 256 20 Nils Rostoks 2004-01-26 Illumina
ABC16258_R01 CTCCACGGCACAATCACCTG 677 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC16258_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes