Details of Primer Pair 'ABC16273_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC16273_L01R01580Nils Rostoks2004-01-26 ABC16273_L01 GACCACTTCTGGTTTGGGCG 1044 20 Nils Rostoks 2004-01-26 Illumina
ABC16273_R01 CCGCAATGTTTTAGGGCAGC 1623 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC16273_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes