Details of Primer Pair 'ABC16431_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC16431_L01R01410Nils Rostoks2004-01-26 ABC16431_L01 TGCCGCAGTGGAAGAAATGA 549 20 Nils Rostoks 2004-01-26 Illumina
ABC16431_R01 CAAAACGCAGACCCCTACGC 958 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC16431_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes