Details of Primer Pair 'ABC16534_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC16534_L01R01407Nils Rostoks2004-01-26 ABC16534_L01 TGTCCAAACGGCTCACCGTA 59 20 Nils Rostoks 2004-01-26 Illumina
ABC16534_R01 GGCTTCCCATCAACATTGGC 465 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC16534_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes