Details of Primer Pair 'ABC16710_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC16710_L01R01417Nils Rostoks2004-01-26 ABC16710_L01 CGCTCTCACGGACGTGTTTG 161 20 Nils Rostoks 2004-01-26 Illumina
ABC16710_R01 GAGAGGCCGGAAAAAGTGGC 577 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC16710_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes