Details of Primer Pair 'ABC16978_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC16978_L01R01426Nils Rostoks2004-01-26 ABC16978_L01 AGCGCAGCTCAGATGGTCCT 348 20 Nils Rostoks 2004-01-26 Illumina
ABC16978_R01 ATGGCCATTATGGTGGCAGC 773 20 Nils Rostoks 2004-01-26 Illumina

Comment History of 'ABC16978_L01R01'

DateSubmitterComment
2004-01-26 Nils Rostoks SCRI SNP discovery project in abiotic stress genes