Details of Primer Pair 'ABC16991_L01R01'

PairEst Prod SizeSubmitterDatePrimerSequenceStartLengthSubmitterDateSource
ABC16991_L01R01181Nils Rostoks2005-03-17 ABC16991_L01 CGCCGTTCCAGTTTAACTTC 231 20 Nils Rostoks 2005-03-17 Invitrogen
ABC16991_R01 GGGCTTCCCCTCCTTTGTAT 412 20 Nils Rostoks 2005-03-17 Invitrogen

Comment History of 'ABC16991_L01R01'

DateSubmitterComment
2005-03-17 Nils Rostoks Joanne Russell primers for mapping in OWB